ID: 1122597069_1122597077

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1122597069 1122597077
Species Human (GRCh38) Human (GRCh38)
Location 14:102901158-102901180 14:102901193-102901215
Sequence CCCCTGCTGTGTGGGGGAGTCCT CCCGTTCTGTGCTTGAGGTCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 16, 4: 174} {0: 1, 1: 0, 2: 0, 3: 3, 4: 100}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!