ID: 1122609274_1122609280

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1122609274 1122609280
Species Human (GRCh38) Human (GRCh38)
Location 14:102970112-102970134 14:102970136-102970158
Sequence CCCTCTCAGTTAAGGGCAGAGAC CCCGCCCAGCACTACCTTGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 160} {0: 1, 1: 0, 2: 0, 3: 6, 4: 72}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!