ID: 1122617952_1122617954

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1122617952 1122617954
Species Human (GRCh38) Human (GRCh38)
Location 14:103033840-103033862 14:103033853-103033875
Sequence CCACACAGCAGTTTCCTCACTGG TCCTCACTGGAAGTGCATTGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 278} {0: 1, 1: 0, 2: 0, 3: 14, 4: 119}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!