ID: 1122620962_1122620973

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1122620962 1122620973
Species Human (GRCh38) Human (GRCh38)
Location 14:103057473-103057495 14:103057512-103057534
Sequence CCTCCCCGCCGCCGCCGCCGCAG AGCCTAGCGCTGCGCAAGCCCGG
Strand - +
Off-target summary {0: 2, 1: 17, 2: 233, 3: 618, 4: 1810} {0: 1, 1: 0, 2: 0, 3: 7, 4: 75}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!