ID: 1122635313_1122635324

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1122635313 1122635324
Species Human (GRCh38) Human (GRCh38)
Location 14:103126996-103127018 14:103127048-103127070
Sequence CCGGCGCAGTGGAGGAGCTGAAG GGCGCGGCCGCTGCTGGCGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 196} {0: 1, 1: 1, 2: 5, 3: 43, 4: 463}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!