ID: 1122658565_1122658573

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1122658565 1122658573
Species Human (GRCh38) Human (GRCh38)
Location 14:103279204-103279226 14:103279225-103279247
Sequence CCGCCAGGGCTGCCGGGGTGTGC GCTGCTGGGGAGCGTGGAGTGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 1, 3: 21, 4: 202} {0: 1, 1: 0, 2: 4, 3: 58, 4: 1090}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!