ID: 1122658621_1122658636

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1122658621 1122658636
Species Human (GRCh38) Human (GRCh38)
Location 14:103279465-103279487 14:103279514-103279536
Sequence CCTCGTTCCGGGCCGTGAGGCCG GGAACCCGGGGCCGTCCCGCGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 4, 4: 52} {0: 1, 1: 1, 2: 0, 3: 8, 4: 106}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!