ID: 1122658622_1122658639

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1122658622 1122658639
Species Human (GRCh38) Human (GRCh38)
Location 14:103279472-103279494 14:103279520-103279542
Sequence CCGGGCCGTGAGGCCGCCGAGCA CGGGGCCGTCCCGCGGGTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 107} {0: 1, 1: 0, 2: 3, 3: 19, 4: 156}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!