ID: 1122706963_1122706975

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1122706963 1122706975
Species Human (GRCh38) Human (GRCh38)
Location 14:103628049-103628071 14:103628102-103628124
Sequence CCCTGGAAAAACCGAGGAGCACT CAGGGTTCACAAAGGGCTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 95} {0: 1, 1: 0, 2: 1, 3: 23, 4: 181}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!