ID: 1122707186_1122707205

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1122707186 1122707205
Species Human (GRCh38) Human (GRCh38)
Location 14:103628925-103628947 14:103628964-103628986
Sequence CCACCCCGCGAGCCGCGCCCTGC CCGTCCGCGTTACAACCGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 44, 4: 457} {0: 1, 1: 0, 2: 0, 3: 0, 4: 2}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!