ID: 1122718819_1122718828

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1122718819 1122718828
Species Human (GRCh38) Human (GRCh38)
Location 14:103710904-103710926 14:103710924-103710946
Sequence CCCGCCCTCGGTTTAATAATCAG CAGGGTAGGCAAAGGAAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 61} {0: 1, 1: 0, 2: 2, 3: 91, 4: 952}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!