ID: 1122718951_1122718964

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1122718951 1122718964
Species Human (GRCh38) Human (GRCh38)
Location 14:103711692-103711714 14:103711735-103711757
Sequence CCACCCAGCCTCTCCCAGGAAGG GCCCGAGCCTGGCCCAGCAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 65, 4: 586} {0: 1, 1: 0, 2: 2, 3: 15, 4: 193}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!