ID: 1122727363_1122727370

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1122727363 1122727370
Species Human (GRCh38) Human (GRCh38)
Location 14:103766478-103766500 14:103766524-103766546
Sequence CCTCACCACCTGGCTGCAGCTTG ACAGCCATTTATTATGTCAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 56, 4: 408} {0: 1, 1: 0, 2: 4, 3: 19, 4: 195}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!