|
Left Crispr |
Right Crispr |
| Crispr ID |
1122735137 |
1122735144 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
14:103834672-103834694
|
14:103834703-103834725
|
| Sequence |
CCTCCGCCCTCCGGGTGCAAGTG |
CCCTCAGCCTCCTGAGTAACTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 3, 2: 287, 3: 6927, 4: 41949} |
{0: 46, 1: 4104, 2: 109949, 3: 215584, 4: 243501} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|