|
Left Crispr |
Right Crispr |
| Crispr ID |
1122735676 |
1122735681 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
14:103839347-103839369
|
14:103839368-103839390
|
| Sequence |
CCGGGCACAGTGGCTCACGCCTG |
TGTTAACCCCAGCACTTTGGGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 7488, 1: 42205, 2: 102868, 3: 132676, 4: 135912} |
{0: 1, 1: 8, 2: 45, 3: 399, 4: 5062} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|