ID: 1122758664_1122758668

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1122758664 1122758668
Species Human (GRCh38) Human (GRCh38)
Location 14:104003473-104003495 14:104003501-104003523
Sequence CCTTCACCCTTCTAGATAGATAT GTTAGGATCTAGATCCCCATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 163} {0: 1, 1: 0, 2: 1, 3: 0, 4: 52}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!