ID: 1122789187_1122789201

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1122789187 1122789201
Species Human (GRCh38) Human (GRCh38)
Location 14:104177202-104177224 14:104177253-104177275
Sequence CCCACACACGGTCCAGCTCCCGC GGGGCCCCCAAGCCCCCTGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 87} {0: 1, 1: 0, 2: 0, 3: 15, 4: 255}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!