ID: 1122799690_1122799708

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1122799690 1122799708
Species Human (GRCh38) Human (GRCh38)
Location 14:104223393-104223415 14:104223432-104223454
Sequence CCTGCCGCCCCCGCCCCCACCCC CTCTGACAACCTCCTGCCTGGGG
Strand - +
Off-target summary {0: 2, 1: 10, 2: 152, 3: 1086, 4: 7077} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!