ID: 1122817507_1122817514

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1122817507 1122817514
Species Human (GRCh38) Human (GRCh38)
Location 14:104320880-104320902 14:104320896-104320918
Sequence CCGGGGAGCCGCCCACACCCAGC ACCCAGCTGGAGAGGAGGAGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 51, 4: 589}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!