ID: 1122835583_1122835591

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1122835583 1122835591
Species Human (GRCh38) Human (GRCh38)
Location 14:104429310-104429332 14:104429342-104429364
Sequence CCTTGTTTTGATGACCTTGACAG GCCCTGGGCGGGCACTTTGAAGG
Strand - +
Off-target summary {0: 6, 1: 21, 2: 46, 3: 68, 4: 228} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!