ID: 1122844553_1122844554

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1122844553 1122844554
Species Human (GRCh38) Human (GRCh38)
Location 14:104485455-104485477 14:104485468-104485490
Sequence CCAATTAGTGTTGGCTATTGCAT GCTATTGCATAGCCATGCTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 95} {0: 1, 1: 0, 2: 2, 3: 6, 4: 83}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!