ID: 1122859643_1122859656

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1122859643 1122859656
Species Human (GRCh38) Human (GRCh38)
Location 14:104576806-104576828 14:104576855-104576877
Sequence CCCCTACGGCAGAGGGAGCTGGG CTCCTGCTACAGAGGGAGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 174} {0: 1, 1: 2, 2: 2, 3: 26, 4: 240}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!