ID: 1122859686_1122859690

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1122859686 1122859690
Species Human (GRCh38) Human (GRCh38)
Location 14:104577035-104577057 14:104577051-104577073
Sequence CCTCAGCTGGGCGTTTTCACTAC TCACTACCACAGAGGGAGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 70} {0: 1, 1: 1, 2: 1, 3: 18, 4: 162}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!