ID: 1122861606_1122861616

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1122861606 1122861616
Species Human (GRCh38) Human (GRCh38)
Location 14:104585066-104585088 14:104585080-104585102
Sequence CCTCCCCCTTCTCAGCCCTTGGG GCCCTTGGGGGCAGGGTCCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 66, 4: 545} {0: 1, 1: 0, 2: 4, 3: 34, 4: 353}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!