ID: 1122861888_1122861898

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1122861888 1122861898
Species Human (GRCh38) Human (GRCh38)
Location 14:104586507-104586529 14:104586536-104586558
Sequence CCGCGTGGGGCCCGCGGGTGTGC GAGAGGGTAAGGCGGGCCGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 114} {0: 1, 1: 0, 2: 2, 3: 3, 4: 182}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!