|
Left Crispr |
Right Crispr |
| Crispr ID |
1122864453 |
1122864456 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
14:104597231-104597253
|
14:104597246-104597268
|
| Sequence |
CCATCTCCTGGGCAACCCCCACC |
CCCCCACCAGCAGCACCCCCCGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 0, 2: 4, 3: 57, 4: 477} |
{0: 1, 1: 0, 2: 10, 3: 75, 4: 665} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|