ID: 1122865407_1122865414

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1122865407 1122865414
Species Human (GRCh38) Human (GRCh38)
Location 14:104601786-104601808 14:104601808-104601830
Sequence CCCTTCCTGACAGCAGGAGCTGC CCCGGACCTGACCTCCAGTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 301} {0: 1, 1: 0, 2: 2, 3: 10, 4: 136}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!