ID: 1122880782_1122880788

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1122880782 1122880788
Species Human (GRCh38) Human (GRCh38)
Location 14:104689629-104689651 14:104689643-104689665
Sequence CCGTCCGAGCCTTGCGGAGCGCG CGGAGCGCGGCAGTGGGCGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 38} {0: 1, 1: 0, 2: 1, 3: 32, 4: 218}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!