ID: 1122882716_1122882723

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1122882716 1122882723
Species Human (GRCh38) Human (GRCh38)
Location 14:104697224-104697246 14:104697247-104697269
Sequence CCCACACTGTGCTGTGGAAGGCC CTCCTCGCCTGGCTCCTGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 184} {0: 1, 1: 0, 2: 1, 3: 33, 4: 327}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!