ID: 1122882716_1122882729

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1122882716 1122882729
Species Human (GRCh38) Human (GRCh38)
Location 14:104697224-104697246 14:104697265-104697287
Sequence CCCACACTGTGCTGTGGAAGGCC GGAGGCAAGTGAGGGAGCCGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 184} {0: 1, 1: 0, 2: 13, 3: 58, 4: 491}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!