ID: 1122883698_1122883704

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1122883698 1122883704
Species Human (GRCh38) Human (GRCh38)
Location 14:104701216-104701238 14:104701252-104701274
Sequence CCCCTAACCCTCAGCATGGCACG CAGCAGAGAAACTGAGACCGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 78} {0: 1, 1: 0, 2: 1, 3: 31, 4: 312}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!