ID: 1122884031_1122884038

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1122884031 1122884038
Species Human (GRCh38) Human (GRCh38)
Location 14:104702645-104702667 14:104702661-104702683
Sequence CCATTCTCAGCCCGTCTCCCCAG TCCCCAGCCTGGGCCTGGCAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 38, 4: 383} {0: 1, 1: 0, 2: 9, 3: 74, 4: 742}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!