ID: 1122890158_1122890162

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1122890158 1122890162
Species Human (GRCh38) Human (GRCh38)
Location 14:104728517-104728539 14:104728536-104728558
Sequence CCTGCAAGCAGAGCCCAGAAGGG AGGGAGTGAAGCAGTGTAAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 274} {0: 1, 1: 0, 2: 0, 3: 26, 4: 349}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!