ID: 1122891164_1122891174

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1122891164 1122891174
Species Human (GRCh38) Human (GRCh38)
Location 14:104732913-104732935 14:104732961-104732983
Sequence CCAGGAGGGTGCTGTGACCCCCA CAGGGCCTGCCCCGTCCCGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 19, 4: 259} {0: 1, 1: 0, 2: 1, 3: 17, 4: 187}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!