ID: 1122891274_1122891280

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1122891274 1122891280
Species Human (GRCh38) Human (GRCh38)
Location 14:104733320-104733342 14:104733368-104733390
Sequence CCCTGCGAAGGGGCTTCAGGGCT TGTGAAGTTACGTCCCAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 135} {0: 1, 1: 0, 2: 0, 3: 4, 4: 74}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!