ID: 1122893530_1122893541

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1122893530 1122893541
Species Human (GRCh38) Human (GRCh38)
Location 14:104744036-104744058 14:104744072-104744094
Sequence CCGAAGATGGACCAGGAAGGGAG GCATCAGTGGGTGGGTGGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 236} {0: 1, 1: 0, 2: 7, 3: 66, 4: 739}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!