ID: 1122903671_1122903677

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1122903671 1122903677
Species Human (GRCh38) Human (GRCh38)
Location 14:104792346-104792368 14:104792363-104792385
Sequence CCTGCCAGGGCCCACACCAGGAA CAGGAAGCCACTCAGATGGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 321} {0: 1, 1: 0, 2: 0, 3: 33, 4: 273}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!