ID: 1122932691_1122932702

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1122932691 1122932702
Species Human (GRCh38) Human (GRCh38)
Location 14:104941968-104941990 14:104942018-104942040
Sequence CCTCCATCTTTGGCGCAGACACA GGGGACAACATCCCAAAGGATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 7, 3: 11, 4: 114} {0: 1, 1: 0, 2: 1, 3: 13, 4: 184}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!