ID: 1122940287_1122940305

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1122940287 1122940305
Species Human (GRCh38) Human (GRCh38)
Location 14:104978147-104978169 14:104978188-104978210
Sequence CCCAGGGGAGCGGGCTGCAGGCG CCGGGGGTTCCGGGCCAGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 276} {0: 1, 1: 0, 2: 0, 3: 16, 4: 244}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!