ID: 1122946134_1122946150

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1122946134 1122946150
Species Human (GRCh38) Human (GRCh38)
Location 14:105010991-105011013 14:105011041-105011063
Sequence CCAGAACAGCCTCTGCCTGGCGC GCCTAGGGCTGCAGCCCCACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 219} {0: 1, 1: 0, 2: 2, 3: 26, 4: 239}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!