ID: 1122951546_1122951556

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1122951546 1122951556
Species Human (GRCh38) Human (GRCh38)
Location 14:105047778-105047800 14:105047816-105047838
Sequence CCCCAGCTGCGCCCGTCCTGCAG CCCTCCGCCCACAGCCCTCGAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!