ID: 1122952895_1122952907

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1122952895 1122952907
Species Human (GRCh38) Human (GRCh38)
Location 14:105055646-105055668 14:105055694-105055716
Sequence CCACAGTGTCCTCAAGCTCCCTC CCTTCCTTTCAAAGGCGGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 39, 4: 319} {0: 1, 1: 0, 2: 1, 3: 13, 4: 150}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!