ID: 1122968685_1122968704

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1122968685 1122968704
Species Human (GRCh38) Human (GRCh38)
Location 14:105143757-105143779 14:105143810-105143832
Sequence CCGGGGTCCTGCAGTGGCGACTT GGGGAGGAGTGGAGGGGTGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 106} {0: 1, 1: 6, 2: 71, 3: 527, 4: 3906}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!