ID: 1122968686_1122968694

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1122968686 1122968694
Species Human (GRCh38) Human (GRCh38)
Location 14:105143764-105143786 14:105143788-105143810
Sequence CCTGCAGTGGCGACTTCACCACC GGCAGTGAGTGGGGAGTAGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 104} {0: 1, 1: 0, 2: 8, 3: 53, 4: 539}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!