ID: 1122968686_1122968699

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1122968686 1122968699
Species Human (GRCh38) Human (GRCh38)
Location 14:105143764-105143786 14:105143799-105143821
Sequence CCTGCAGTGGCGACTTCACCACC GGGAGTAGCGGGGGGAGGAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 104} {0: 1, 1: 1, 2: 15, 3: 228, 4: 2506}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!