ID: 1122969536_1122969551

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1122969536 1122969551
Species Human (GRCh38) Human (GRCh38)
Location 14:105146920-105146942 14:105146973-105146995
Sequence CCCTCCTCCGTCTGCTTCTGCAG CTGCTGCGTCGGACCAGCCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 373} {0: 1, 1: 0, 2: 0, 3: 5, 4: 93}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!