ID: 1122972592_1122972601

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1122972592 1122972601
Species Human (GRCh38) Human (GRCh38)
Location 14:105158463-105158485 14:105158483-105158505
Sequence CCCTCTGCCCCCGGGCCACCTGG TGGCCCTTGTACCCCAGCCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 40, 4: 380} {0: 1, 1: 0, 2: 1, 3: 25, 4: 672}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!