ID: 1122975436_1122975458

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1122975436 1122975458
Species Human (GRCh38) Human (GRCh38)
Location 14:105168904-105168926 14:105168941-105168963
Sequence CCTGCCAGCGCCCCGGCCCGGCG CGCCCGGGCGGCGGGGGCACGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 6, 3: 57, 4: 546} {0: 1, 1: 0, 2: 3, 3: 45, 4: 413}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!