ID: 1122978129_1122978133

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1122978129 1122978133
Species Human (GRCh38) Human (GRCh38)
Location 14:105179353-105179375 14:105179370-105179392
Sequence CCCCTGGGTGGCAGCCAGCGTCC GCGTCCAGCCCAATGTCCCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 12, 4: 194} {0: 1, 1: 0, 2: 0, 3: 7, 4: 75}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!