ID: 1122981813_1122981822

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1122981813 1122981822
Species Human (GRCh38) Human (GRCh38)
Location 14:105195439-105195461 14:105195476-105195498
Sequence CCACACTCTCTTGCTGACTTCCC AAGGAAGTCCAGAAGGAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 48, 4: 494} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!